Filters
Question type

Study Flashcards

Women are cautioned against having children later in life because the incidence of Down syndrome (trisomy 21) increases rapidly with age.What is the best explanation for this phenomenon?


A) Somatic mutations accumulate as a woman gets older,leading to changes in the uterine environment that cause down syndrome.
B) Germ line mutations accumulate as a woman ages,so a larger percentage of her eggs have mutations.
C) Germ line mutations accumulate as a woman gets older,leading to changes in the uterine environment that cause down syndrome.
D) Somatic mutations accumulate as a woman ages,so a larger percentage of her eggs have mutations.
E) Somatic mutations accumulate as a woman ages,so the developing embryo is more likely to acquire mutations that lead to down syndromE.

F) C) and E)
G) A) and D)

Correct Answer

verifed

verified

Which of the following types of physical mutagens produces thymine dimer mutations?


A) ultraviolet light
B) X-rays
C) microwave
D) gamma rays
E) ionizing radiation

F) A) and D)
G) C) and D)

Correct Answer

verifed

verified

Which of the following would occur from a mutation in the gene's promoter region?


A) The sequence of the mature mRNA would change.
B) The ability of pre-mRNA to be properly spliced would change.
C) The ability of mRNA to be translationally regulated would change.
D) The amino acid sequence of the translated protein would be altereD.
E) The rate of transcription may increase or decreasE.

F) B) and D)
G) A) and E)

Correct Answer

verifed

verified

Most oncogenes encode proteins that function in cell growth signaling pathways.

A) True
B) False

Correct Answer

verifed

verified

When cancer cells have the ability to migrate to other parts of the body,they are said to be


A) invasive.
B) benign.
C) metastatiC.
D) oncogenic.
E) genetic.

F) None of the above
G) A) and D)

Correct Answer

verifed

verified

Based on the gene and protein sequences that follow,what type of mutation has occurred and what is its effect on the polypeptide? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp


A) base addition - silent
B) substitution - misense
C) base addition - missense
D) substitution - frameshift
E) base addition - frameshift

F) A) and B)
G) A) and C)

Correct Answer

verifed

verified

Which of the following base pairs would be targeted and repaired by a mismatch repair system?


A) A -T
B) C-G
C) A-G
D) A-G and C-G
E) A-T and C-G

F) D) and E)
G) B) and E)

Correct Answer

verifed

verified

p53 is a tumor suppressor gene that acts as a sensor of DNA damage.

A) True
B) False

Correct Answer

verifed

verified

Showing 41 - 48 of 48

Related Exams

Show Answer